CRISPRscan

CRISPRscan is a novel algorithm to predict gRNA efficiency.

Based on a large scale analysis of sgRNA mutagenesis activity in zebrafish, we established rules to predict sgRNA activity in vivo and build the CRISPRscan model integrating these rules. We independently validated with success our predictions using sgRNAs different from the large scale analysis.

Off-target predictions

CRISPRscan searches for potential genomic off-targets with the following rules.

Cas9

All
According to Hsu et al. Nature Biotechnology 2013, potential off-targets can have a maximum of 2 mismatches with the sgRNA.
Seed
With the method published by Cong et al. Science 2013, potential off-targets must match perfectly in their seed (12 nt 3’ of the PAM sequence) and a maximum of 2 mismatches in the rest of the sgRNA. This rule is more stringent than the All method and therefore less off-targets are found.
CFD (Cutting Frequency Determination)
Doench et al. Nature Biotechnology 2016 measured the cutting efficiency of potential off-targets and integrated them into the CFD score. Potential off-targets with up to 4 mismatches are scored with Doench et al. matrix.

Cpf1

All
Potential off-targets can have a maximum of 2 mismatches with the gRNA.
Seed
The experiments published by Kim et al. Nature Methods 2017 support potential off-targets that must match perfectly in their seed (6 nt 3’ of the PAM sequence) and a maximum of 2 mismatches in the rest of the gRNA. This rule is more stringent than the All method and therefore less off-targets are found.

gRNA generation

Detailed information can be found in our protocols:

Cas9

Oligo sequences
Oligo 1. sgRNA primerT7 promoterTarget sequenceTail annealing sequence
5’ TAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAA
alternative promoterSp6 promoter
5’ ATTTAGGTGACACTATAGANNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAA
Oligo 2. Tail primerTailTail annealing sequence
5’ AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC

Cpf1

Oligo sequences
LbCpf1
Oligo 1. Tail primerT7 promoterTail sequence
5’ CCCTAATACGACTCACTATAGGTAATTTCTACTAAGTGTAGAT
Oligo 2. crRNA primerTarget sequence (reverse)Tail sequence
5’ NNNNNNNNNNNNNNNNNNNNNNNATCTACACTTAGTAGAAATTA
AsCpf1
Oligo 1. Tail primerT7 promoterTail sequence
5’ CCCTAATACGACTCACTATAGGTAATTTCTACTCTTGTAGAT
Oligo 2. crRNA primerTarget sequence (reverse)Tail sequence
5’ NNNNNNNNNNNNNNNNNNNNNNNATCTACAAGAGTAGAAATTA
NB
  • Oligo containing the target sequence are reported 5' to 3' ready to be ordered in the "Oligo" column, i.e. Cpf1 crRNA primer is reported reverse-complement of the target as shown above.
  • CCC upstream of promoter are optional aiming to increase stability of oligo.

Genomes and genes

Sequences of genomes and annotations of genes were obtained from these sources:

NameSourceAssembly
Arabidopsis thaliana Arabidopsis thaliana Ensembl genomes 57 TAIR10
Cow Bos taurus Ensembl 110 ARS-UCD1.2
Worm Caenorhabditis elegans Ensembl 110 WBcel235
Marmoset Callithrix jacchus Ensembl 110 mCalJac1.pat.X
Ciona Ciona intestinalis Ensembl 110 KH
Zebrafish Danio rerio Ensembl 110 GRCz11
Zebrafish NHGRI (SNP only) Danio rerio Nhgri GRCz11
Fly Drosophila melanogaster Ensembl 110 BDGP6.46
Chicken Gallus gallus Ensembl 110 bGalGal1.mat.broiler.GRCg7b
Soybean Glycine max Ensembl genomes 57 Glycine_max_v2.1
Human Homo sapiens Ensembl 110 GRCh38
Green sea urchin Lytechinus variegatus Ensembl genomes 57 Lvar_3.0
Sea walnut Mnemiopsis leidyi Ensembl genomes 57 MneLei_Aug2011
Mouse Mus musculus Ensembl 110 GRCm39
Sea anemone Nematostella vectensis Ensembl genomes 57 ASM20922v1
Killifish Nothobranchius furzeri Brunet NotFur1
Rice Oryza sativa Ensembl genomes 57 IRGSP-1.0
Medaka Oryzias latipes Ensembl 110 ASM223467v1
Chimpanzee Pan troglodytes Ensembl 110 Pan_tro_3.0
Bat star Patiria miniata Ensembl genomes 57 GCA015706575v1
Sea lamprey Petromyzon marinus Stowers kPetmar1
Rat Rattus norvegicus Ensembl 110 mRatBN7.2
Yeast Saccharomyces cerevisiae Ensembl 110 R64-1-1
Sorghum Sorghum bicolor Ensembl genomes 57 Sorghum_bicolor_NCBIv3
Purple sea urchin Strongylocentrotus purpuratus Ensembl genomes 57 Spur_5.0
Frog Xenopus laevis Xenbase Xenopus_laevis_v10.1
Frog Xenopus tropicalis Ensembl 110 UCB_Xtro_10.0
Corn Zea mays Ensembl genomes 57 Zm-B73-REFERENCE-NAM-5.0

Plasmid: Cas9 with nanos 3’-UTR

Plasmid for targeting Cas9 expression into the germ line is available at Addgene.