CRISPRscan

CRISPRscan is a novel algorithm to predict gRNA efficiency.

Based on a large scale analysis of sgRNA mutagenesis activity in zebrafish, we established rules to predict sgRNA activity in vivo and build the CRISPRscan model integrating these rules. We independently validated with success our predictions using sgRNAs different from the large scale analysis.

Off-target predictions

CRISPRscan searches for potential genomic off-targets with the following rules.

Cas9

All
According to Hsu et al. Nature Biotechnology 2013, potential off-targets can have a maximum of 2 mismatches with the sgRNA.
Seed
With the method published by Cong et al. Science 2013, potential off-targets must match perfectly in their seed (12 nt 3’ of the PAM sequence) and a maximum of 2 mismatches in the rest of the sgRNA. This rule is more stringent than the All method and therefore less off-targets are found.
CFD (Cutting Frequency Determination)
Doench et al. Nature Biotechnology 2016 measured the cutting efficiency of potential off-targets and integrated them into the CFD score. Potential off-targets with up to 4 mismatches are scored with Doench et al. matrix.

Cpf1

All
Potential off-targets can have a maximum of 2 mismatches with the gRNA.
Seed
The experiments published by Kim et al. Nature Methods 2017 support potential off-targets that must match perfectly in their seed (6 nt 3’ of the PAM sequence) and a maximum of 2 mismatches in the rest of the gRNA. This rule is more stringent than the All method and therefore less off-targets are found.

gRNA generation

Detailed information can be found in our protocols:

Cas9

Oligo sequences
Oligo 1. sgRNA primerT7 promoterTarget sequenceTail annealing sequence
5’ TAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAA
alternative promoterSp6 promoter
5’ ATTTAGGTGACACTATAGANNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAA
Oligo 2. Tail primerTailTail annealing sequence
5’ AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC

Cpf1

Oligo sequences
LbCpf1
Oligo 1. Tail primerT7 promoterTail sequence
5’ CCCTAATACGACTCACTATAGGTAATTTCTACTAAGTGTAGAT
Oligo 2. crRNA primerTarget sequence (reverse)Tail sequence
5’ NNNNNNNNNNNNNNNNNNNNNNNATCTACACTTAGTAGAAATTA
AsCpf1
Oligo 1. Tail primerT7 promoterTail sequence
5’ CCCTAATACGACTCACTATAGGTAATTTCTACTCTTGTAGAT
Oligo 2. crRNA primerTarget sequence (reverse)Tail sequence
5’ NNNNNNNNNNNNNNNNNNNNNNNATCTACAAGAGTAGAAATTA
NB
  • Oligo containing the target sequence are reported 5' to 3' ready to be ordered in the "Oligo" column, i.e. Cpf1 crRNA primer is reported reverse-complement of the target as shown above.
  • CCC upstream of promoter are optional aiming to increase stability of oligo.

Genomes and genes

Sequences of genomes and annotations of genes were obtained from these sources:

NameSourceAssembly
Zebrafish Danio rerio Ensembl 104 GRCz11
Zebrafish NHGRI (SNP only) Danio rerio nhgri snp Nhgri GRCz11
Fly Drosophila melanogaster Ensembl 104 BDGP6.32
Worm Caenorhabditis elegans Ensembl 104 WBcel235
Human Homo sapiens Ensembl 104 GRCh38
Medaka Oryzias latipes Ensembl 104 ASM223467v1
Yeast Saccharomyces cerevisiae Ensembl 104 R64-1-1
Sea walnut Mnemiopsis leidyi Ensembl genomes 51 MneLei_Aug2011
Mouse Mus musculus Ensembl 104 GRCm39
Sea anemone Nematostella vectensis Ensembl genomes 51 ASM20922v1
Rat Rattus norvegicus Ensembl 104 Rnor_6.0
Sea urchin Strongylocentrotus purpuratus Ensembl genomes 51 Spur_5.0
Frog Xenopus laevis Xenbase Xenopus_laevis_v2
Frog Xenopus tropicalis Xenbase Xenopus_tropicalis_v10.0
Killifish Nothobranchius furzeri Brunet NotFur1
Cow Bos taurus Ensembl 104 ARS-UCD1.2
Marmoset Callithrix jacchus Ensembl 104 ASM275486v1
Ciona Ciona intestinalis Ensembl 104 KH
Chicken Gallus gallus Ensembl 104 GRCg6a
Chimpanzee Pan troglodytes Ensembl 104 Pan_tro_3.0

Plasmid: Cas9 with nanos 3’-UTR

Plasmid for targeting Cas9 expression into the germ line is available at Addgene.