CRISPRscan

CRISPRscan is a novel algorithm to predict gRNA efficiency.

Based on a large scale analysis of sgRNA mutagenesis activity in zebrafish, we established rules to predict sgRNA activity in vivo and build the CRISPRscan model integrating these rules. We independently validated with success our predictions using sgRNAs different from the large scale analysis.

Off-target predictions

CRISPRscan searches for potential genomic off-targets with the following rules.

Cas9

All
According to Hsu et al. Nature Biotechnology 2013, potential off-targets can have a maximum of 2 mismatches with the sgRNA.
Seed
With the method published by Cong et al. Science 2013, potential off-targets must match perfectly in their seed (12 nt 3' of the PAM sequence) and a maximum of 2 mismatches in the rest of the sgRNA. This rule is more stringent than the All method and therefore less off-targets are found.
CFD (Cutting Frequency Determination)
Doench et al. Nature Biotechnology 2016 measured the cutting efficiency of potential off-targets and integrated them into the CFD score. Potential off-targets with up to 4 mismatches are scored with Doench et al. matrix.

Cpf1

All
Potential off-targets can have a maximum of 2 mismatches with the gRNA.
Seed
The experiments published by Kim et al. Nature Methods 2017 support potential off-targets that must match perfectly in their seed (6 nt 3' of the PAM sequence) and a maximum of 2 mismatches in the rest of the gRNA. This rule is more stringent than the All method and therefore less off-targets are found.

gRNA generation

Detailed information can be found in our protocol.

Cas9

Oligo sequences
Oligo 1. sgRNA primerT7 promoterTarget sequenceTail annealing sequence
5’ TAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAA
alternative promoterSp6 promoter
5’ ATTTAGGTGACACTATAGANNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAA
Oligo 2. Tail primerTailTail annealing sequence
5’ AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC

Cpf1

Oligo sequences
LbCpf1
Oligo 1. Tail primerT7 promoterTail sequence
5’ CCCTAATACGACTCACTATAGGTAATTTCTACTAAGTGTAGAT
Oligo 2. crRNA primerTarget sequence (reverse)Tail sequence
5’ NNNNNNNNNNNNNNNNNNNNNNNATCTACACTTAGTAGAAATTA
AsCpf1
Oligo 1. Tail primerT7 promoterTail sequence
5’ CCCTAATACGACTCACTATAGGTAATTTCTACTCTTGTAGAT
Oligo 2. crRNA primerTarget sequence (reverse)Tail sequence
5’ NNNNNNNNNNNNNNNNNNNNNNNATCTACAAGAGTAGAAATTA
NB
  • Oligo containing the target sequence are reported 5' to 3' ready to be ordered in the "Oligo" column, i.e. Cpf1 crRNA primer is reported reverse-complement of the target as shown above.
  • CCC upstream of promoter are optional aiming to increase stability of oligo.

Gene annotation

Gene annotations were downloaded from Ensembl 87, Ensembl Genomes 34, and Xenbase.

Plasmid: Cas9 with nanos 3’-UTR

Plasmid for targeting Cas9 expression into the germ line is available at Addgene.